SIPA1

Ensembl ID:
ENSDARG00000076697
Description:
signal-induced proliferation-associated 1 [Source:HGNC Symbol;Acc:10885]
Human Orthologue:
SIPA1
Human Description:
signal-induced proliferation-associated 1 [Source:HGNC Symbol;Acc:10885]
Mouse Orthologue:
Sipa1
Mouse Description:
signal-induced proliferation associated gene 1 Gene [Source:MGI Symbol;Acc:MGI:107576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27112 Nonsense Mutation detected in F1 DNA During 2018
sa21157 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108916 Nonsense 2 1261 1 15
Genomic Location (Zv9):
Chromosome 7 (position 75616263)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71910386
GRCz11 7 72159843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAAAACACAAGAGCTTCCTACATCTTTCAAATCAGCAGGACATCATG[C/T]AGTCGGACGATCTGTTCATCCGCAAGTTCCGCAGGCAGAGCCCTCGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108916 Nonsense 571 1261 5 15
Genomic Location (Zv9):
Chromosome 7 (position 75601423)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71895546
GRCz11 7 72145003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCATGTTTCACGTCTCCACCATGCTTCCATACACAGCCAACAACAAA[C/T]AACAGGTAAAACACCCCATTAGAGTGCAGAAACAATACGTGCCACAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link