wu:fj67f05

Ensembl ID:
ENSDARG00000076627
ZFIN ID:
ZDB-GENE-030131-9385
Human Orthologue:
C19orf61
Human Description:
chromosome 19 open reading frame 61 [Source:HGNC Symbol;Acc:25763]
Mouse Orthologue:
1500002O20Rik
Mouse Description:
RIKEN cDNA 1500002O20 gene Gene [Source:MGI Symbol;Acc:MGI:1919247]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36124 Nonsense Mutation detected in F1 DNA During 2018
sa2858 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa36124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109459 Nonsense 188 505 5 13
Genomic Location (Zv9):
Chromosome 16 (position 26966829)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24812504
GRCz11 16 24727536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTAAATGTATGCTTAATGTGTGTTTTTGTACCTCAGTACCTGCGAGAC[C/T]AGACGGATATGCTAGTAGTTGGAGTTATTGGACTACAAGGCACAGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2858
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109459 Essential Splice Site 353 505 9 13
Genomic Location (Zv9):
Chromosome 16 (position 26969183)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24814858
GRCz11 16 24729890
KASP Assay ID:
554-3043.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACCGGCTCCTCAGGGCCAGATGACGGATCAGAGTATTATCCTCACA[T/G]AGGTGCAAAAACTAGTAATGCTTATTAGTGTTCCTTAATCATTTTTCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link