zgc:175175

Ensembl ID:
ENSDARG00000076614
ZFIN ID:
ZDB-GENE-080516-4
Description:
hypothetical protein LOC797780 [Source:RefSeq peptide;Acc:NP_001120947]
Human Orthologue:
C3orf32
Human Description:
chromosome 3 open reading frame 32 [Source:HGNC Symbol;Acc:24809]
Mouse Orthologue:
D630042P16Rik
Mouse Description:
RIKEN cDNA D630042P16 gene Gene [Source:MGI Symbol;Acc:MGI:2443733]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19303 Nonsense Mutation detected in F1 DNA During 2018
sa9481 Nonsense Available for shipment Available now
sa17965 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109841 Nonsense 61 211 4 9
ENSDART00000139706 Nonsense 61 203 4 8
ENSDART00000109841 Nonsense 61 211 4 9
ENSDART00000139706 Nonsense 61 203 4 8
Genomic Location (Zv9):
Chromosome 22 (position 33686023)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31047561
GRCz11 22 30996756
KASP Assay ID:
554-6169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGCATTCCTGCGATCAGTGAAGAACTTGCACAGGAGGCCTTTACT[G/T]AATATGTGTCCAGCAAATGCTGTTACAGCTCCAAACCAGTCAAAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109841 Nonsense 61 211 4 9
ENSDART00000139706 Nonsense 61 203 4 8
ENSDART00000109841 Nonsense 61 211 4 9
ENSDART00000139706 Nonsense 61 203 4 8
Genomic Location (Zv9):
Chromosome 22 (position 33686023)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31047561
GRCz11 22 30996756
KASP Assay ID:
554-6169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCSTCAGCATTCCTGCGATCAGTGAAGAACTTGCACWGGARGCCTTTACT[G/T]AATATGTGTCCAGCAAATGCWGTTACAGCTCCAAACCAGTCAAAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109841 Nonsense 188 211 8 9
ENSDART00000139706 Nonsense 188 203 8 8
Genomic Location (Zv9):
Chromosome 22 (position 33680680)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 31042218
GRCz11 22 30991413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYTGTGTGGATTCWGTGGTGGCATGGGYTGGACTAACTATGGCCAACGC[C/T]AGTTTTGTGGTGTGTGTGGGGGCAYTGGCAGGCAAAGGTACNNNNTTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link