
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:175175
- Ensembl ID:
- ENSDARG00000076614
- ZFIN ID:
- ZDB-GENE-080516-4
- Description:
- hypothetical protein LOC797780 [Source:RefSeq peptide;Acc:NP_001120947]
- Human Orthologue:
- C3orf32
- Human Description:
- chromosome 3 open reading frame 32 [Source:HGNC Symbol;Acc:24809]
- Mouse Orthologue:
- D630042P16Rik
- Mouse Description:
- RIKEN cDNA D630042P16 gene Gene [Source:MGI Symbol;Acc:MGI:2443733]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19303 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9481 | Nonsense | Available for shipment | Available now |
sa17965 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19303
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109841 | Nonsense | 61 | 211 | 4 | 9 |
ENSDART00000139706 | Nonsense | 61 | 203 | 4 | 8 |
ENSDART00000109841 | Nonsense | 61 | 211 | 4 | 9 |
ENSDART00000139706 | Nonsense | 61 | 203 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 33686023)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 31047561 GRCz11 22 30996756 - KASP Assay ID:
- 554-6169.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTCAGCATTCCTGCGATCAGTGAAGAACTTGCACAGGAGGCCTTTACT[G/T]AATATGTGTCCAGCAAATGCTGTTACAGCTCCAAACCAGTCAAAGAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9481
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109841 | Nonsense | 61 | 211 | 4 | 9 |
ENSDART00000139706 | Nonsense | 61 | 203 | 4 | 8 |
ENSDART00000109841 | Nonsense | 61 | 211 | 4 | 9 |
ENSDART00000139706 | Nonsense | 61 | 203 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 33686023)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 31047561 GRCz11 22 30996756 - KASP Assay ID:
- 554-6169.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCSTCAGCATTCCTGCGATCAGTGAAGAACTTGCACWGGARGCCTTTACT[G/T]AATATGTGTCCAGCAAATGCWGTTACAGCTCCAAACCAGTCAAAGAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17965
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109841 | Nonsense | 188 | 211 | 8 | 9 |
ENSDART00000139706 | Nonsense | 188 | 203 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 33680680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 31042218 GRCz11 22 30991413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTYTGTGTGGATTCWGTGGTGGCATGGGYTGGACTAACTATGGCCAACGC[C/T]AGTTTTGTGGTGTGTGTGGGGGCAYTGGCAGGCAAAGGTACNNNNTTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: