zgc:158605

Ensembl ID:
ENSDARG00000076602
ZFIN ID:
ZDB-GENE-070112-732
Description:
hypothetical protein LOC556307 [Source:RefSeq peptide;Acc:NP_001074031]
Human Orthologue:
PRSS16
Human Description:
protease, serine, 16 (thymus) [Source:HGNC Symbol;Acc:9480]
Mouse Orthologue:
Prss16
Mouse Description:
protease, serine, 16 (thymus) Gene [Source:MGI Symbol;Acc:MGI:1859181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24997 Nonsense Mutation detected in F1 DNA During 2018
sa45553 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077386 Nonsense 11 488 1 9
Genomic Location (Zv9):
Chromosome 15 (position 42175191)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43447159
GRCz11 15 43327798
KASP Assay ID:
554-7508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATCAGTTCCTCAACATGGCTTTAGGTTGTTATAGTTTTCTGAAATA[T/A]GCTGCTATTGTTTTGTCGTGTGTTTTGTTTAGCCCGTGTGCTGCTCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077386 Nonsense 414 488 8 9
Genomic Location (Zv9):
Chromosome 15 (position 42140009)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43411977
GRCz11 15 43292616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGCACATCACTGGACGAGGCCATTCAGCAGACCAATGAGGAATAT[G/T]GAGGATATGACATCAAATCCACACGCATCGTCTTCCCCAATGGATCCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link