zgc:92249

Ensembl ID:
ENSDARG00000076563
ZFIN ID:
ZDB-GENE-040718-368
Description:
retinoic acid receptor responder protein 3 [Source:RefSeq peptide;Acc:NP_001002623]
Human Orthologues:
HRASLS2, HRASLS5, PLA2G16, RARRES3
Human Descriptions:
HRAS-like suppressor 2 [Source:HGNC Symbol;Acc:17824]
HRAS-like suppressor family, member 5 [Source:HGNC Symbol;Acc:24978]
phospholipase A2, group XVI [Source:HGNC Symbol;Acc:17825]
retinoic acid receptor responder (tazarotene induced) 3 [Source:HGNC Symbol;Acc:9869]
Mouse Orthologues:
Hrasls5, Pla2g16
Mouse Descriptions:
HRAS-like suppressor family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1913977]
phospholipase A2, group XVI Gene [Source:MGI Symbol;Acc:MGI:2179715]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45523 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025549 Nonsense 20 170 3 5
ENSDART00000133389 Nonsense 20 170 3 5
ENSDART00000133477 Nonsense 20 170 3 5

The following transcripts of ENSDARG00000076563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 48503739)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46581398
GRCz11 14 45568690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCTAGTTTGATCAGAAGCCAGAGCCCGGAGATCTGATTGAAATCTTC[A/T]GAGGTGGATATCAGCACTGGGCTATATATGTGGGTGAAGGTTATGGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link