
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92249
- Ensembl ID:
- ENSDARG00000076563
- ZFIN ID:
- ZDB-GENE-040718-368
- Description:
- retinoic acid receptor responder protein 3 [Source:RefSeq peptide;Acc:NP_001002623]
- Human Orthologues:
- HRASLS2, HRASLS5, PLA2G16, RARRES3
- Human Descriptions:
- HRAS-like suppressor 2 [Source:HGNC Symbol;Acc:17824]
- HRAS-like suppressor family, member 5 [Source:HGNC Symbol;Acc:24978]
- phospholipase A2, group XVI [Source:HGNC Symbol;Acc:17825]
- retinoic acid receptor responder (tazarotene induced) 3 [Source:HGNC Symbol;Acc:9869]
- Mouse Orthologues:
- Hrasls5, Pla2g16
- Mouse Descriptions:
- HRAS-like suppressor family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1913977]
- phospholipase A2, group XVI Gene [Source:MGI Symbol;Acc:MGI:2179715]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45523 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45523
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025549 | Nonsense | 20 | 170 | 3 | 5 |
ENSDART00000133389 | Nonsense | 20 | 170 | 3 | 5 |
ENSDART00000133477 | Nonsense | 20 | 170 | 3 | 5 |
The following transcripts of ENSDARG00000076563 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 14 (position 48503739)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 46581398 GRCz11 14 45568690 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCCTAGTTTGATCAGAAGCCAGAGCCCGGAGATCTGATTGAAATCTTC[A/T]GAGGTGGATATCAGCACTGGGCTATATATGTGGGTGAAGGTTATGGGATT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: