
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
RB1CC1
- Ensembl ID:
- ENSDARG00000076559
- Description:
- RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
- Human Orthologue:
- RB1CC1
- Human Description:
- RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
- Mouse Orthologue:
- Rb1cc1
- Mouse Description:
- RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37934 | Nonsense | Available for shipment | Available now |
sa44173 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24535 | Nonsense | Available for shipment | Available now |
sa24536 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37934
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113014 | Nonsense | 512 | 1625 | 8 | 22 |
- Genomic Location (Zv9):
- Chromosome 24 (position 36477392)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 35096307 GRCz11 24 34982572 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCTTGCTGTAGTGGAGGTGGTCCGGCGCAAAATGTTCATAGGACACTA[C/A]AGACAAGTAAGAATCTGCTGCTTTACTTTGTGTGATTATAGGGAATGGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44173
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113014 | Nonsense | 831 | 1625 | 13 | 22 |
- Genomic Location (Zv9):
- Chromosome 24 (position 36480607)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 35099522 GRCz11 24 34985787 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGAAAAGTTAAAGAAGACCTTTATCATTTTCGAGGTCTTGTTCTGAAA[G/T]AGCAACGGGACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24535
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113014 | Nonsense | 866 | 1625 | 13 | 22 |
- Genomic Location (Zv9):
- Chromosome 24 (position 36480712)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 35099627 GRCz11 24 34985892 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAA[C/T]AAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24536
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113014 | Splice Site, Nonsense | 1576 | 1625 | 21 | 22 |
- Genomic Location (Zv9):
- Chromosome 24 (position 36497657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 35116572 GRCz11 24 35002837 - KASP Assay ID:
- 2261-8953.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAATATTACTCACTCTTTCTTTTTTTCCCCCTTTTTCTTTTTTCTTTTTC[T/A]AGCGACAGGAGCAACAAGACGGCCGTGGGTTCTGGGAAAAGTCATGGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: