zgc:193801

Ensembl ID:
ENSDARG00000076552
ZFIN ID:
ZDB-GENE-081022-40
Description:
hypothetical protein LOC564476 [Source:RefSeq peptide;Acc:NP_001124254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37264 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113899 Nonsense 30 467 2 8
ENSDART00000134091 Nonsense 26 286 2 6
Genomic Location (Zv9):
Chromosome 21 (position 14301043)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16001998
GRCz11 21 16097975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACCGAACACACTTACACTCCTGTGCTGTGTCAGGATGAGAAGTGTT[T/A]GGGGCAGGAGAAAGGTGTGCACATGCACTGCCCACTGTGTGCTGTGACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link