si:dkey-266m15.5

Ensembl ID:
ENSDARG00000076548
ZFIN ID:
ZDB-GENE-070705-442
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WVJ3]
Human Orthologue:
AC091196.1
Human Description:
Mps one binder kinase activator-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q70IA6]
Mouse Orthologue:
2700078K21Rik
Mouse Description:
RIKEN cDNA 2700078K21 gene Gene [Source:MGI Symbol;Acc:MGI:1919891]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110701 Nonsense 219 238 5 5
ENSDART00000142647   None 183 None 5
Genomic Location (Zv9):
Chromosome 18 (position 5871470)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6826571
GRCz11 18 6785533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCACCTCAACACACTCTTCACACACTTCATCAYCTTCAGCCACATGTTC[A/T]GACTGCTGGAGCCCTCGGAGACGGCGCCGATYGATGACCTCATCGCCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link