zgc:172109

Ensembl ID:
ENSDARG00000076530
ZFIN ID:
ZDB-GENE-090610-2
Description:
hypothetical protein LOC795922 [Source:RefSeq peptide;Acc:NP_001103876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1100 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1100
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090862 Essential Splice Site None 315 2 2
Genomic Location (Zv9):
Chromosome 7 (position 9297245)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8244610
GRCz11 7 8490568
KASP Assay ID:
554-1002.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATAATAATCATGATGCTAATTTTGTGATCTTTATATCTAATTTCCTC[A/T]KAGATGGCCTACCCAATAACAGTATGGCAATGTGGTGGTGAAGAAGGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link