wu:fe16b04

Ensembl ID:
ENSDARG00000076529
ZFIN ID:
ZDB-GENE-030131-4968
Human Orthologue:
MN1
Human Description:
meningioma (disrupted in balanced translocation) 1 [Source:HGNC Symbol;Acc:7180]
Mouse Orthologue:
Mn1
Mouse Description:
meningioma 1 Gene [Source:MGI Symbol;Acc:MGI:1261813]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45387 Nonsense Mutation detected in F1 DNA During 2018
sa9533 Nonsense Available for shipment Available now
sa45388 Nonsense Mutation detected in F1 DNA During 2018
sa17687 Nonsense Available for shipment Available now
sa12981 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114533 Nonsense 42 1033 1 2
Genomic Location (Zv9):
Chromosome 10 (position 4103715)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4095709
GRCz11 10 4096013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTAGCTGTGGAGCCAATGATGGGTCCCCTAAATGAATCCCCTATGCAG[G/T]GACTCAACTTTGTCTCGAATAGAGATCAGTATGGGTTCCAGACTCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114533 Nonsense 90 1033 1 2
Genomic Location (Zv9):
Chromosome 10 (position 4103860)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4095854
GRCz11 10 4096158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACATGCAAGGACCATTCAACCATCAACCTCCTAACCACGACCAGCATT[C/A]RCATCTGTACCAGGACAGCGTTCCCTCTTGCCTGCACGGCGACAGGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114533 Nonsense 274 1033 1 2
Genomic Location (Zv9):
Chromosome 10 (position 4104411)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4096405
GRCz11 10 4096709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAGGGCCCATGATGGGCAGCTCAAAAGTTGACCAGCAGCTACCTCAG[C/T]AAAATGTGTTTTCTGACCGATTTGGAAATAGGGGCAAAATGGATCCGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114533 Nonsense 318 1033 1 2
Genomic Location (Zv9):
Chromosome 10 (position 4104543)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4096537
GRCz11 10 4096841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACCAGGACCTGTTGTCAGGCAGAACCCTGGTTCCCCTGCCCTCCCT[C/T]GATTTTATCACACTCCAGACTTTGTAGCAAACAATACAGATGTTCAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114533 Nonsense 613 1033 2 2
Genomic Location (Zv9):
Chromosome 10 (position 4105461)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4097455
GRCz11 10 4097759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCACAGACAGGAGGCCGGCTGAATTCGGAGGGATGGTGATGAGGAGG[C/T]AGCACAGCTTCCCTCCTGGAGGGCCAAGTCAACAGGGAGCCCCCCAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link