vwc2

Ensembl ID:
ENSDARG00000076495
ZFIN ID:
ZDB-GENE-090313-315
Description:
von Willebrand factor C domain containing 2 [Source:RefSeq peptide;Acc:NP_001108100]
Human Orthologue:
VWC2
Human Description:
von Willebrand factor C domain containing 2 [Source:HGNC Symbol;Acc:30200]
Mouse Orthologue:
Vwc2
Mouse Description:
von Willebrand factor C domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442987]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30970 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110237 Nonsense 248 309 2 3
ENSDART00000147868 Nonsense 248 309 3 4
Genomic Location (Zv9):
Chromosome 13 (position 16229799)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16049834
GRCz11 13 16180826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGTTCAGTGTCAGCTTGCCCACAGACAGAGTGTGTTGATCCGGAGTA[T/G]GAGCCTGACCAGTGCTGTCCAGTGTGTAAGAGCGGTAAGTGTTCGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link