stab1l

Ensembl ID:
ENSDARG00000076484
ZFIN ID:
ZDB-GENE-050208-554
Description:
stabilin-1 [Source:RefSeq peptide;Acc:NP_001182543]
Human Orthologue:
STAB1
Human Description:
stabilin 1 [Source:HGNC Symbol;Acc:18628]
Mouse Orthologue:
Stab1
Mouse Description:
stabilin 1 Gene [Source:MGI Symbol;Acc:MGI:2178742]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32382 Essential Splice Site Available for shipment Available now
sa24084 Essential Splice Site Available for shipment Available now
sa31 Nonsense Available for shipment Available now
sa15222 Nonsense Available for shipment Available now
sa12102 Nonsense Available for shipment Available now
sa43775 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39359 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43774 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29727 Nonsense Mutation detected in F1 DNA During 2018
sa13932 Nonsense Available for shipment Available now
sa37438 Essential Splice Site Available for shipment Available now
sa32381 Nonsense Available for shipment Available now
sa24083 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 221 2553 7 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10456151)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10316319
GRCz11 22 10346001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTATGCGAATGTCTGCCTGGAAACAAATTTGGGCAAGCATGTTTAG[G/T]TATGTAGCATGTGCATACATAACACATACATTTAGCGTGTTTGTTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 285 2553 9 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10453326)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10313494
GRCz11 22 10343176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGATTCAAATTCAATGTTGTTTTTGAGCTCTATGTGTTTCCTCTCCA[G/A]TCTAAATGTGTGTGTTTGCCTGGAATGGAGTCATCAGATCCATCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 289 2553 9 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10453311)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10313479
GRCz11 22 10343161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTGTTTTTGAGCTCTATGTGTTTCCTCTCCAGTCTAAATGTGTGTG[T/A]TTGCCTGGAATGGAGTCATCAGATCCATCCAAAGGATGCACACAGAAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 762 2553 22 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096 Nonsense 60 556 2 15
Genomic Location (Zv9):
Chromosome 22 (position 10441150)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10301318
GRCz11 22 10331000
KASP Assay ID:
2261-6461.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTGAAGCAGCGTTTACAGGTGTCGGTTGCCACCTCTGCTCAAACCCC[A/T]AAAAGCACGGAGAAAACTGTGACGAAGGTRAACTTRTAGACCTCATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 933 2553 26 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096 Nonsense 231 556 6 15
Genomic Location (Zv9):
Chromosome 22 (position 10434317)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10294485
GRCz11 22 10324167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGAATGTAGCTGCAAGAAAGGCTACATGGGAGATGGTATCATCTGT[A/T]AAATYGTCAACCCCTGTTTGTCAGATAATGGAGGCTGCCATTCTTTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 1039 2553 30 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096 Essential Splice Site 337 556 10 15
Genomic Location (Zv9):
Chromosome 22 (position 10432036)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10292204
GRCz11 22 10321886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAATAGACTAAATGCCAAGAGATCATATTTGTGTGTGATTTCTCTCT[A/C]GAGTTCATTTTTTAGAGGGCATCTACACCTCTGAAGACTTGAGGCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 1101 2553 31 69
ENSDART00000133363   None 1219 None 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096 Essential Splice Site 399 556 11 15
Genomic Location (Zv9):
Chromosome 22 (position 10431749)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10291917
GRCz11 22 10321599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCCAGATATCAAGGCAATAAATGGGTGCATTCACATTATAGACACGG[T/A]AATGTCACTGTGCAACACCCAAGCAACAGCATGGCAACACCTCAAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 2010 2553 56 69
ENSDART00000133363 Essential Splice Site 676 1219 19 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10415371)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10275539
GRCz11 22 10305221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTGTGAGCTCTGTCTCGCCAATCACTTTGGGCCAAACTGCACAGG[T/A]AATTCATTCAGGCCTTTATACAGTTGAAGTCAGAATTATTAGCCCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 2035 2553 57 69
ENSDART00000133363 Nonsense 701 1219 20 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10411463)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10271631
GRCz11 22 10301313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATGAAGGCCTGGACGGTGACGGCAGCTGTTTTTGTCAGGAGGGATG[G/A]ATGGGTGAAAGCTGCCAGACAGCAATCGGTATGAACGTTAGTAGTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 2107 2553 59 69
ENSDART00000133363 Nonsense 773 1219 22 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10403288)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10263456
GRCz11 22 10293138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRTTGCCATGAAGAAGCCGACTGTATGCAGTCAGGTATCAACATTACCTG[T/A]TCCTGTCAGACGGGATACTCCGGAGACGGACATGTTTGCGAGCCTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 2193 2553 60 69
ENSDART00000133363 Essential Splice Site 859 1219 23 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10402944)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10263112
GRCz11 22 10292794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACGGCGGCTGCGACCCAAAGGCGATATGCAGAGACCTTCATTTCCACA[G/A]TACTCACTTGCTGATATAATTAACTCTTTAATTATGCCCTAATATTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Nonsense 2209 2553 61 69
ENSDART00000133363 Nonsense 875 1219 24 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10401858)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10262026
GRCz11 22 10291708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGAAAACTGCAGGTGTTTTCCATCTGCGCTCACCTGAGGGAAAGTA[T/G]AAAATGAACTTCACGCAAGCAAAGCAGGCTTGTGAAGCAGAGGGAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092050 Essential Splice Site 2238 2553 61 69
ENSDART00000133363 Essential Splice Site 904 1219 24 32
ENSDART00000142939   None 91 None 3
ENSDART00000147096   None 556 None 15
Genomic Location (Zv9):
Chromosome 22 (position 10401769)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10261937
GRCz11 22 10291619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGGAGCCAATCTTGCCACGTTTTCCCAGCTCTCTGATGCCCAACAGG[T/C]GATTTTTGGTGAATTTGTGCTTTTAAAATGCAATTATTAAAGAGATAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link