zgc:173770

Ensembl ID:
ENSDARG00000076476
ZFIN ID:
ZDB-GENE-070822-29
Description:
dopey family member 2 [Source:RefSeq peptide;Acc:NP_956904]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20319 Nonsense Available for shipment Available now
sa40341 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109306 Nonsense 25 531 2 2
Genomic Location (Zv9):
Chromosome 4 (position 61139617)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75552333
GRCz11 4 77129071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAATCCAGACTCCAGATACCATAAGTCCGTTAGTTTTAGGATCTT[C/A]AACCCCATATGTAGCTGTATCATTGCCCCAAGTAACTAGTCAATTGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109306 Nonsense 310 531 2 2
Genomic Location (Zv9):
Chromosome 4 (position 61138763)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75551479
GRCz11 4 77128217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCACTATGACTGGTTCTTCTGCTCCCTTCACTTTGCAAAAACTACTC[C/T]AGGGTAAAAGTTCAACAAGCCAGGTTATTTCAGTACCTTCAACCCCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link