si:rp71-56i13.1

Ensembl ID:
ENSDARG00000076438
ZFIN ID:
ZDB-GENE-060503-377
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LY26]
Human Orthologue:
ZPLD1
Human Description:
zona pellucida-like domain containing 1 [Source:HGNC Symbol;Acc:27022]
Mouse Orthologue:
Zpld1
Mouse Description:
zona pellucida like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443415]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114312 Nonsense 124 477 4 12
ENSDART00000138780 Nonsense 20 315 1 7
Genomic Location (Zv9):
Chromosome 10 (position 30711961)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29917864
GRCz11 10 29804204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATCACGGTGATGTGTGGCACGAACAGGATAGATCTGCAGATTTTGT[T/A]GTGTCCCATGTATTTCAATGGATACAGTGAATCGATGGTGGCTCTGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link