zgc:163143

Ensembl ID:
ENSDARG00000076437
ZFIN ID:
ZDB-GENE-070410-143
Description:
hypothetical protein LOC795946 [Source:RefSeq peptide;Acc:NP_001077038]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1113 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113036 Essential Splice Site 303 413 9 12
Genomic Location (Zv9):
Chromosome 3 (position 34691211)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34476407
GRCz11 3 34605915
KASP Assay ID:
554-1015.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATTGTCATGCATTAATTGGTTGACATTTTCATGTCTTTATCTCTGTT[A/C]GATTAACCGTGAACTGAAGAAACACCTGAGGTTRAATGCAAACGCTTTAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link