
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A0PJR2_DANRE
- Ensembl ID:
- ENSDARG00000076431
- Description:
- Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A0PJR2]
- Mouse Orthologue:
- Ppp1r9b
- Mouse Description:
- protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22041 | Nonsense | Available for shipment | Available now |
sa41970 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22041
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109521 | Nonsense | 468 | 801 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 10483255)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9706749 GRCz11 12 9744592 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACGACAGGAGGAATGATGACGTGGACCCCATGGCTGCTTCTGCTGAGTA[T/A]GAGCTGGAGAAACGTGTGGAAAGGCTGGACCTGTTCCCCGTCGAGCTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41970
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109521 | Nonsense | 529 | 801 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 10724509)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 9711931 GRCz11 12 9749774 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGAGGTCATTTCTCAATGTCATGCTGCTTATTTTTCCCATTCAGGATA[C/T]AAGTGAATGATTTGATTGTGGAGGTGGATGGAACAAGCCTGGTTGGTGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: