zgc:175140

Ensembl ID:
ENSDARG00000076417
ZFIN ID:
ZDB-GENE-030131-3586
Description:
hypothetical protein LOC324863 [Source:RefSeq peptide;Acc:NP_001120937]
Human Orthologue:
FNIP1
Human Description:
folliculin interacting protein 1 [Source:HGNC Symbol;Acc:29418]
Mouse Orthologue:
Fnip1
Mouse Description:
folliculin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2444668]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32363 Nonsense Available for shipment Available now
sa9714 Essential Splice Site Available for shipment Available now
sa43727 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099448 Nonsense 54 1077 2 20
Genomic Location (Zv9):
Chromosome 21 (position 43682297)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45479437
GRCz11 21 45521774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCAGTCAGATCCGGCTGATCGTCTACCAGGACTGCGAGCGGCGTGGA[C/T]GAAATGTCCTCTTTGACTCGGATGCCAGAAAGAGAAGCACAGAAGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099448 Essential Splice Site 152 1077 4 20
Genomic Location (Zv9):
Chromosome 21 (position 43674929)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45486211
GRCz11 21 45528548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGCCATGAGCTACAAGGGTTCAACGCTGAAGATCCACCAGATAAGG[T/A]GAGACTRAAGGCACAGCRGTCAGAATTAACCATGCAAAAATCTGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099448 Essential Splice Site 237 1077 8 20
Genomic Location (Zv9):
Chromosome 21 (position 43669809)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45491377
GRCz11 21 45533714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCGGGTGTGTGTAAACTCTCTCTTACAGTGTTTCTCTGCCTCCGCTC[A/C]GGACACAGTAACCCAATGGACATGCCTGGACGAGGCCTGTATGACGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099448 Nonsense 850 1077 14 20
Genomic Location (Zv9):
Chromosome 21 (position 43658612)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45502573
GRCz11 21 45544910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTAGAGCAGAAGAAAGCAGCTCCTCTGAATGACTGGGAGATCCCT[C/T]GAAACGAGAGCTCGGACAGCGCTCTGGGGGACAGCGAGAGCGAGGACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link