
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-217f16.6
- Ensembl ID:
- ENSDARG00000076389
- ZFIN ID:
- ZDB-GENE-091117-15
- Human Orthologue:
- TNRC6B
- Human Description:
- trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
- Mouse Orthologue:
- Tnrc6b
- Mouse Description:
- trinucleotide repeat containing 6b Gene [Source:MGI Symbol;Acc:MGI:2443730]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19928 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19928
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123512 | Essential Splice Site | 71 | 381 | 2 | 9 |
ENSDART00000137102 | None | 278 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 3675374)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 3136795 GRCz11 3 2615912 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCGCCATGCTCGGCGGCATTAATCCACACATGCAGCAGTTCCAGCTGG[T/G]ATGGCTTATTTTGAGTCTTGTAGTTGCAGTTATTGTAGAAGCGTTGTGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
- Prostate cancer: A meta-analysis of genome-wide association studies to identify prostate cancer susceptibility loci associated with aggressive and non-aggressive disease. (View Study)
- Prostate cancer: Sequence variants at 22q13 are associated with prostate cancer risk. (View Study)
- Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
- Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: