si:dkey-225n22.2

Ensembl ID:
ENSDARG00000076373
ZFIN ID:
ZDB-GENE-091204-64
Human Orthologue:
VOPP1
Human Description:
vesicular, overexpressed in cancer, prosurvival protein 1 [Source:HGNC Symbol;Acc:34518]
Mouse Orthologue:
Vopp1
Mouse Description:
vesicular, overexpressed in cancer, prosurvival protein 1 Gene [Source:MGI Symbol;Acc:MGI:2141658]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37803 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39432 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108762 Essential Splice Site 36 175 2 5
ENSDART00000139748   None 73 None 2
Genomic Location (Zv9):
Chromosome 24 (position 529874)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 469846
GRCz11 24 199505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAGAAGTACTGCTGGTATTCTGAGGGAGGATACCCCCTCTTCTTTAT[G/A]TAAGTACAGTGCTGTGGTGTTACGTGCTGATCTGGAGTCAGTGTTAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108762 Nonsense 59 175 3 5
ENSDART00000139748 Nonsense 23 73 1 2
Genomic Location (Zv9):
Chromosome 24 (position 527377)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 467349
GRCz11 24 197008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGGAACCCGCTGCTGCATCAGGGCTCTCTCCATACAGAGACTCTG[G/A]TACTTCTGGTAGGATCAACTTTTATTAAATAATTCATTAAATGTATTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link