si:dkey-46g23.3

Ensembl ID:
ENSDARG00000076366
ZFIN IDs:
ZDB-GENE-070705-477, ZDB-GENE-080205-1
Description:
hypothetical protein LOC100136837 [Source:RefSeq peptide;Acc:NP_001108028]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19930 Nonsense Available for shipment Available now
sa18745 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14917 Essential Splice Site, Missense Available for shipment Available now
sa44554 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25976 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109071 Nonsense 211 1462 6 35
ENSDART00000110995 Nonsense 211 1456 6 34
ENSDART00000113517 Nonsense 211 606 6 17
ENSDART00000115331 Nonsense 211 1453 6 34
Genomic Location (Zv9):
Chromosome 3 (position 3944913)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3629463
GRCz11 3 3411716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACAAATGTTTCCTCCGTGAACTGGATTTTGGAGCTTTCTCATGTTT[T/A]AATCCCAGAAGCTCAGGTTGGGACGTACACACTGAGGGCTTATATTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109071 Essential Splice Site 922 1462 21 35
ENSDART00000110995 Essential Splice Site 916 1456 20 34
ENSDART00000113517   None 606 None 17
ENSDART00000115331 Essential Splice Site 913 1453 20 34
Genomic Location (Zv9):
Chromosome 3 (position 3939281)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3623831
GRCz11 3 3406084
KASP Assay ID:
2261-7176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCATCAAGAGGACGCATTGACATAGTCACTCGAAGTCTGCGAGTTCTG[G/A]TTTGTAACTAATTCTGAAGTTTGAAAATAGAGCCCATGTGTTGGTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109071 Missense 940 1462 22 35
ENSDART00000110995 Essential Splice Site 933 1456 21 34
ENSDART00000113517   None 606 None 17
ENSDART00000115331 Essential Splice Site 930 1453 21 34
Genomic Location (Zv9):
Chromosome 3 (position 3939144)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3623694
GRCz11 3 3405947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGAAGGAGTKGAAAGRACCTTCACACGSAGTTGGTTACTCTGTCCAAAGG[G/A]TTTGTTTAKCTCAGAATTTATTYTRCATTGCTTGCTCCTAGAGCTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109071 Essential Splice Site 1360 1462 31 35
ENSDART00000110995 Essential Splice Site 1354 1456 30 34
ENSDART00000113517 Essential Splice Site 504 606 13 17
ENSDART00000115331 Essential Splice Site 1351 1453 30 34
Genomic Location (Zv9):
Chromosome 3 (position 3936550)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3621100
GRCz11 3 3403353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGACTGCCAGGCTGCACCAGTCAATCTGATGTTGACCTTCACAGTCAA[G/A]TAAATATTGCTTTTTAATATTGTTAAGGCTGCGCAGTTCTTTGTAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109071 Essential Splice Site 1360 1462 31 35
ENSDART00000110995 Essential Splice Site 1354 1456 30 34
ENSDART00000113517 Essential Splice Site 504 606 13 17
ENSDART00000115331 Essential Splice Site 1351 1453 30 34
Genomic Location (Zv9):
Chromosome 3 (position 3936549)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3621099
GRCz11 3 3403352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACTGCCAGGCTGCACCAGTCAATCTGATGTTGACCTTCACAGTCAAG[T/A]AAATATTGCTTTTTAATATTGTTAAGGCTGCGCAGTTCTTTGTAAAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link