LOC100333855

Ensembl ID:
ENSDARG00000076361
Human Orthologue:
B4GALNT2
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 [Source:HGNC Symbol;Acc:24136]
Mouse Orthologue:
B4galnt2
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI Symbol;Acc:MGI:1342058]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5995 Nonsense Mutation detected in F1 DNA During 2018
sa45844 Nonsense Mutation detected in F1 DNA During 2018
sa37993 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111231 Nonsense 119 481 4 11
Genomic Location (Zv9):
Chromosome 25 (position 5649780)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5183004
GRCz11 25 5310874
KASP Assay ID:
554-3719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAAAATGACGTGCTTATTCTGGCTCCTGCAAACACTCCACTCCAGTA[T/G]CCAATTAAAGGCTTCAGAGTCACTCCTATGAATAAAACAYGCATTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111231 Nonsense 394 481 10 11
Genomic Location (Zv9):
Chromosome 25 (position 5663237)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5196461
GRCz11 25 5324331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGACCAGGGCACCTCTGCCAGGGTTTGACGGCTGCTTTTTCGTAGAC[G/T]GAGTCGTCAACTATTTCATGGGTCGAACGGAGGCTGTGCGGAAGGTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111231 Nonsense 402 481 10 11
Genomic Location (Zv9):
Chromosome 25 (position 5663261)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5196485
GRCz11 25 5324355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGACGGCTGCTTTTTCGTAGACGGAGTCGTCAACTATTTCATGGGT[C/T]GAACGGAGGCTGTGCGGAAGGTCGGATTTGACCCATTCCTCAAAAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link