zgc:175108

Ensembl ID:
ENSDARG00000076351
ZFIN ID:
ZDB-GENE-080218-16
Description:
hypothetical protein LOC569746 [Source:RefSeq peptide;Acc:NP_001107909]
Human Orthologue:
FAM5C
Human Description:
family with sequence similarity 5, member C [Source:HGNC Symbol;Acc:22393]
Mouse Orthologue:
Fam5c
Mouse Description:
family with sequence similarity 5, member C Gene [Source:MGI Symbol;Acc:MGI:2443035]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20738 Nonsense Available for shipment Available now
sa33893 Nonsense Available for shipment Available now
sa20739 Nonsense Available for shipment Available now
sa31520 Nonsense Available for shipment Available now
sa9532 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111642 Nonsense 340 761 7 8
Genomic Location (Zv9):
Chromosome 6 (position 34058534)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35704953
GRCz11 6 35688336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTACCAACCTTCTATGCTCTGAACACATCTGCCGTGCAGTACTTTTG[G/A]AAGATGGACTCTGGCGTTCAGCAGCGCTTTCAGCTTTTGGAGACCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111642 Nonsense 395 761 8 8
Genomic Location (Zv9):
Chromosome 6 (position 34069161)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35694326
GRCz11 6 35677709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAATAACTTATCATGTTCATTCCTTTACCATAGGCCTCTGAGCTACT[G/A]GCTGAGGTACATCCTTTCCATCATGTACTGCAGCGAGAACAATCAGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111642 Nonsense 405 761 8 8
Genomic Location (Zv9):
Chromosome 6 (position 34069192)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35694295
GRCz11 6 35677678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGGCCTCTGAGCTACTGGCTGAGGTACATCCTTTCCATCATGTACTG[C/A]AGCGAGAACAATCAGATCGGGTCCTACATGGAGGAAACACGGACCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111642 Nonsense 693 761 8 8
Genomic Location (Zv9):
Chromosome 6 (position 34070055)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35693432
GRCz11 6 35676815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTTGATCCTGCAGCTGGACTATCCGTACACACAGGGCTCGCAGGACT[C/A]GGCCTTGCTCCAGCTGCTGGAAATCCGAGATCGGGTCAACCGTCTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111642 Nonsense 713 761 8 8
Genomic Location (Zv9):
Chromosome 6 (position 34070114)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35693373
GRCz11 6 35676756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCTGCTGGAAATCCGAGAYCGGGTCAACCGTCTCTCTCCACCGGGT[C/T]AAMAACCTCTGGATCTGTTTGCCTGCTTATTRCGCCACCGTCTCAAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link