zgc:162883

Ensembl ID:
ENSDARG00000076338
ZFIN ID:
ZDB-GENE-070410-101
Description:
inositol polyphosphate-5-phosphatase K [Source:RefSeq peptide;Acc:NP_001082962]
Human Orthologue:
INPP5K
Human Description:
inositol polyphosphate-5-phosphatase K [Source:HGNC Symbol;Acc:33882]
Mouse Orthologue:
Inpp5k
Mouse Description:
inositol polyphosphate 5-phosphatase K Gene [Source:MGI Symbol;Acc:MGI:1194899]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42586 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35940 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1619 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Essential Splice Site 5 456 2 13
ENSDART00000115176   None 455 None 12
Genomic Location (Zv9):
Chromosome 15 (position 32030355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33986192
GRCz11 15 33844171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAATACTGTCCGTTTGGAGACGAAAGATGGCAAGATGGAGAATTTCGG[G/A]TATGTTTTCACGTCTAGCTTTCATTTAGCATATGCCTTCTCATATTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Essential Splice Site 248 456 8 13
ENSDART00000115176 Essential Splice Site 247 455 7 12
Genomic Location (Zv9):
Chromosome 15 (position 32020766)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33995781
GRCz11 15 33853760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGCCCACCTACAAATTTGACTTGAACTCAGACAACTATGACACAAG[G/A]TACATAACACAATGTGTTCACAATATATCCTGCAGTGTATCTTACTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111434 Nonsense 420 456 12 13
ENSDART00000115176 Nonsense 419 455 11 12
Genomic Location (Zv9):
Chromosome 15 (position 32012441)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34004106
GRCz11 15 33862085
KASP Assay ID:
554-1560.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAGTTCTTGGGGGMGAGTGTGTGCTGTGTTATTACAGCAGCAACCTG[C/T]AGTGTATTGTGGGTATTAGTCAACCTTTCAAGGTAANNNNCACGTCAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link