zgc:92655

Ensembl ID:
ENSDARG00000076334
ZFIN ID:
ZDB-GENE-040718-125
Description:
39S ribosomal protein L43, mitochondrial [Source:RefSeq peptide;Acc:NP_001002428]
Human Orthologue:
MRPL43
Human Description:
mitochondrial ribosomal protein L43 [Source:HGNC Symbol;Acc:14517]
Mouse Orthologue:
Mrpl43
Mouse Description:
mitochondrial ribosomal protein L43 Gene [Source:MGI Symbol;Acc:MGI:2137229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35343 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111486 Nonsense 24 148 1 3
Genomic Location (Zv9):
Chromosome 12 (position 35312826)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33716571
GRCz11 12 33817554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGGTTTTTACAAAGCGTTCTTCAGAATGGAGTGGGTCGCTATGTCTG[T/A]CAGCTAAAGCGAATCTCTCTGATCTTCTCCAAGAAAGGACAGGGGTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link