SORCS1

Ensembl ID:
ENSDARG00000076333
Description:
sortilin-related VPS10 domain containing receptor 1 [Source:HGNC Symbol;Acc:16697]
Human Orthologue:
SORCS1
Human Description:
sortilin-related VPS10 domain containing receptor 1 [Source:HGNC Symbol;Acc:16697]
Mouse Orthologue:
Sorcs1
Mouse Description:
VPS10 domain receptor protein SORCS 1 Gene [Source:MGI Symbol;Acc:MGI:1929666]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25656 Nonsense Mutation detected in F1 DNA During 2018
sa44511 Nonsense Mutation detected in F1 DNA During 2018
sa13076 Essential Splice Site Available for shipment Available now
sa24855 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1430 Essential Splice Site Available for shipment Available now
sa39679 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Nonsense 134 737 4 18
Genomic Location (Zv9):
Chromosome 1 (position 49169696)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47978705
GRCz11 1 48665589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCCCCGGATACATTGACCCAAACTCACTGGTGGTCCAGGATGAGTA[T/A]GTGTTTGTCCAGGTCAGTAATCTATCGAGTGGAGACTAGTTCCCCTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Nonsense 153 737 5 18
Genomic Location (Zv9):
Chromosome 1 (position 49159272)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47969249
GRCz11 1 48656133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAAGGTGTCAACCGGTGGTCGGCCAATCTATTACGTGTCATCCAGA[C/T]GAGACGTGTTTACACCCATGAAGCTTCCCAAATACACCCTTCCAAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Essential Splice Site 168 737 5 18
Genomic Location (Zv9):
Chromosome 1 (position 49159224)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47969201
GRCz11 1 48656085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAGACGTGTTTACACCCATGAAGCTTCCCAAATACACCCTTCCAAAG[G/A]TAGGCCAGCTCATTCGCACTCGCTCGACACGAAGTCAGAGTCTGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Essential Splice Site 277 737 7 18
Genomic Location (Zv9):
Chromosome 1 (position 49147087)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47957134
GRCz11 1 48644018
KASP Assay ID:
554-7892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCTCCGTCGGCGGATCTCAGAGGAAACCGCATTCACTGCATGTTGG[T/C]GAGTGAAAAAAAACGGATGGAGAAAAAGAGAGATTTGTCCAAATGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Essential Splice Site 337 737 9 18
Genomic Location (Zv9):
Chromosome 1 (position 49138399)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47949068
GRCz11 1 48635928
KASP Assay ID:
554-1358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACGTTAGCATGTTCATCACATCCGACGCTGGAAACACRTGGCGGCAG[G/A]TGACTCTGACGGTGGGGTGTTCAGCCAGATGGGGGTGGGCAGTAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114711 Nonsense 706 737 18 18
Genomic Location (Zv9):
Chromosome 1 (position 49109692)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47919671
GRCz11 1 48607093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGCCTGTGATCACGCTGGATGGGAGTGTGTCCTTCACCTTCTCCAGA[G/T]AGGGAATCAGCATCGTCACCGTACAGGTTTCTGCTGGGAACAACATCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link