
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A7MBS5_DANRE
- Ensembl ID:
- ENSDARG00000076332
- Description:
- LOC792773 protein [Source:UniProtKB/TrEMBL;Acc:A7MBS5]
- Human Orthologue:
- IGSF10
- Human Description:
- immunoglobulin superfamily, member 10 [Source:HGNC Symbol;Acc:26384]
- Mouse Orthologue:
- Igsf10
- Mouse Description:
- immunoglobulin superfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI:1923481]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22445 | Nonsense | Available for shipment | Available now |
sa45510 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22445
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112149 | Nonsense | 644 | 861 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 14 (position 15445554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 17307540 GRCz11 14 17613193 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGTTGATAATCAAAACAGTGACACACGAGGATGCTGGAGAGTACAGCTG[T/A]TTAGCAGCTAACCTGTATGGAGCTGATATGTTGTCTCATCTAATTGTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45510
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112149 | Nonsense | 746 | 861 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 14 (position 15445250)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 17307236 GRCz11 14 17612889 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAGAAAACCAAATAACTCTGTCAAGGAGCTTGACCCTAGTCGCTGGGAG[C/T]AGATTGTTGCAAAAGCTAATGCTAAACTGTCAACTGTTCTGCCAGTTACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: