zgc:114069

Ensembl ID:
ENSDARG00000076330
ZFIN ID:
ZDB-GENE-050626-91
Description:
dual specificity protein phosphatase 12 [Source:RefSeq peptide;Acc:NP_001020348]
Human Orthologue:
DUSP12
Human Description:
dual specificity phosphatase 12 [Source:HGNC Symbol;Acc:3067]
Mouse Orthologue:
Dusp12
Mouse Description:
dual specificity phosphatase 12 Gene [Source:MGI Symbol;Acc:MGI:1890614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6832 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114546 Nonsense 92 305 3 7
ENSDART00000136113 Nonsense 92 291 3 7
ENSDART00000143437 Nonsense 61 237 4 8
Genomic Location (Zv9):
Chromosome 2 (position 20433517)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21006127
GRCz11 2 20664099
KASP Assay ID:
554-4645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTAAWGACTAAATTCCTTTTTCTCTCTCTTTTTTGTAGCCATGTGGGG[C/T]AAAGCAGAAGTGCTGMAGTGGTGACTGCTTACCTGATGAAAACACAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link