zgc:171937

Ensembl ID:
ENSDARG00000076320
ZFIN ID:
ZDB-GENE-071004-46
Description:
zgc:171937 (zgc:171937), mRNA [Source:RefSeq DNA;Acc:NM_001109835]
Human Orthologue:
ANO9
Human Description:
anoctamin 9 [Source:HGNC Symbol;Acc:20679]
Mouse Orthologue:
Ano9
Mouse Description:
anoctamin 9 Gene [Source:MGI Symbol;Acc:MGI:1918595]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12271 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115210 Nonsense 207 817 8 24
Genomic Location (Zv9):
Chromosome 25 (position 36230556)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34664296
GRCz11 25 35169254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAACTACCTTGGTGAGAAGGTGGCTCTYTATTTTCTGTGGTTGGGTT[G/A]GTACACAKTTCTCCTGATTCCTGCYTCTGTAATCGGGATCATCGTGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link