Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa41561 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa9164 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa1691 |
Nonsense |
Available for shipment |
Available now |
sa9588 |
Nonsense |
Available for shipment |
Available now |
sa27514 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41562 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa21620 |
Nonsense |
Available for shipment |
Available now |
sa34797 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa31754 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa41561
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57757482)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56189025 |
GRCz11 |
9 |
55539566 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGATTTAACACCATCAGTCAGATCACAGACGCCTCTTTCAGTGGCCTT[C/T]GAAAGCTGGAGCTGCTGATGATGCACGGGAACAACGTGCAGAAGATACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9164
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57761618)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56193161 |
GRCz11 |
9 |
55543702 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACCCCWGGAGCTGTGACTGCCGCATGCGCTGGCTGCAGGACTGGAGCGCT[C/T]GACATCCAGGTCAGACATGATCATATTGTAATGGCGATCTWYTTCTTYAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1691
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57763866)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56195409 |
GRCz11 |
9 |
55545950 |
- KASP Assay ID:
- 554-1637.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAACACCGACTCGAAGAAGGCGTCCAAATRCACGTAGGTTTGGGAACATT[C/T]GACATAGACGGCCCTTTAGGAACAGAGCTGGTTTACCAAACCAAAGACCA
- Associated Phenotype:
Normal
Mutation Details
- Allele Name:
- sa9588
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57764803)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56196346 |
GRCz11 |
9 |
55546887 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CMAAGTGAAGGAAAGTAACTTCCAACAAACTCAGCAAGTGATGCCAAACT[C/A]GAGGYTTCACCCCACAATAKCAACAAATGYATCTGCGGTTTTGAGGTTAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27514
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57765207)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56196750 |
GRCz11 |
9 |
55547291 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAGAGAGGGTGTTACTTCTACTGAAGAGTCTGTAGTCTCCTCCATACTA[C/T]AATCTCAAACCTATCCTCTTTCAAACCCAAATCAAAGCTTCAAAGAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41562
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57765975)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56197518 |
GRCz11 |
9 |
55548059 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACAACCAGACTTGGATTCTAAGGTGGGCCAAAGGAACAGATTAATCCCC[G/T]AACTTGAACTTACAACATCAGTTAACACTCCACCTGCAACTACCAGCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21620
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57766226)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56197769 |
GRCz11 |
9 |
55548310 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGGAACAAACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTA[T/G]CCATACTATCACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34797
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57766235)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56197778 |
GRCz11 |
9 |
55548319 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTATCCATACTA[T/G]CACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATCTCTGACCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31754
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 9 (position 57768591)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
9 |
56200134 |
GRCz11 |
9 |
55550675 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCACGTTCCCAGGATGACGAGTCCACGCCATCAAGACGTAACGGTGTA[T/A]ATAGGAAACACTGCACTCCTGCAATGCCAAGCACAAGGACTCCCAATCCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: