ENSDARG00000076309 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

si:ch211-141h12.1

Ensembl ID:: ENSDARG00000076309
ZFIN ID:: ZDB-GENE-081104-119
Human Orthologue:: MXRA5
Human Description:: matrix-remodelling associated 5 [Source:HGNC Symbol;Acc:7539]

Alleles

There are 9 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa41561	Nonsense	Mutation detected in F1 DNA	During 2018
sa9164	Nonsense	Mutation detected in F1 DNA	During 2018
sa1691	Nonsense	Available for shipment	Available now
sa9588	Nonsense	Available for shipment	Available now
sa27514	Nonsense	Mutation detected in F1 DNA	During 2018
sa41562	Nonsense	Mutation detected in F1 DNA	During 2018
sa21620	Nonsense	Available for shipment	Available now
sa34797	Nonsense	Mutation detected in F1 DNA	During 2018
sa31754	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa41561
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	77	2520	2	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209	Nonsense	68	652	2	4

Genomic Location (Zv9):

Chromosome 9 (position 57757482)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56189025
GRCz11	9	55539566

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ACAGATTTAACACCATCAGTCAGATCACAGACGCCTCTTTCAGTGGCCTT[C/T]GAAAGCTGGAGCTGCTGATGATGCACGGGAACAACGTGCAGAAGATACCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa9164
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	233	2520	3	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209	Nonsense	223	652	3	4

Genomic Location (Zv9):

Chromosome 9 (position 57761618)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56193161
GRCz11	9	55543702

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

ACCCCWGGAGCTGTGACTGCCGCATGCGCTGGCTGCAGGACTGGAGCGCT[C/T]GACATCCAGGTCAGACATGATCATATTGTAATGGCGATCTWYTTCTTYAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa1691
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	716	2520	4	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57763866)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56195409
GRCz11	9	55545950

KASP Assay ID:

554-1637.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TAACACCGACTCGAAGAAGGCGTCCAAATRCACGTAGGTTTGGGAACATT[C/T]GACATAGACGGCCCTTTAGGAACAGAGCTGGTTTACCAAACCAAAGACCA

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

Mutation Details

Allele Name:: sa9588
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1006	2520	5	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57764803)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56196346
GRCz11	9	55546887

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CMAAGTGAAGGAAAGTAACTTCCAACAAACTCAGCAAGTGATGCCAAACT[C/A]GAGGYTTCACCCCACAATAKCAACAAATGYATCTGCGGTTTTGAGGTTAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa27514
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1141	2520	5	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57765207)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56196750
GRCz11	9	55547291

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CAAGAGAGGGTGTTACTTCTACTGAAGAGTCTGTAGTCTCCTCCATACTA[C/T]AATCTCAAACCTATCCTCTTTCAAACCCAAATCAAAGCTTCAAAGAGGAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41562
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1387	2520	6	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57765975)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56197518
GRCz11	9	55548059

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TACAACCAGACTTGGATTCTAAGGTGGGCCAAAGGAACAGATTAATCCCC[G/T]AACTTGAACTTACAACATCAGTTAACACTCCACCTGCAACTACCAGCATG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21620
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > G
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1470	2520	6	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57766226)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56197769
GRCz11	9	55548310

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CCAGGAACAAACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTA[T/G]CCATACTATCACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa34797
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1473	2520	6	8
ENSDART00000144757		None	967	None	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57766235)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56197778
GRCz11	9	55548319

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTATCCATACTA[T/G]CACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATCTCTGACCAC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa31754
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000110561	Nonsense	1656	2520	7	8
ENSDART00000144757	Nonsense	103	967	2	3
ENSDART00000147209		None	652	None	4

Genomic Location (Zv9):

Chromosome 9 (position 57768591)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	9	56200134
GRCz11	9	55550675

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GCTCACGTTCCCAGGATGACGAGTCCACGCCATCAAGACGTAACGGTGTA[T/A]ATAGGAAACACTGCACTCCTGCAATGCCAAGCACAAGGACTCCCAATCCC

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Antineutrophil cytoplasmic antibody-associated vasculitis : Genetically distinct subsets within ANCA-associated vasculitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: