zgc:174908

Ensembl ID:
ENSDARG00000076308
ZFIN ID:
ZDB-GENE-060810-70
Description:
[Source:RefSeq peptide;Acc:NP_001104628]
Human Orthologue:
PDP1
Human Description:
pyruvate dehyrogenase phosphatase catalytic subunit 1 [Source:HGNC Symbol;Acc:9279]
Mouse Orthologue:
Pdp1
Mouse Description:
pyruvate dehyrogenase phosphatase catalytic subunit 1 Gene [Source:MGI Symbol;Acc:MGI:2685870]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22854 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111156 Nonsense 215 519 2 2
Genomic Location (Zv9):
Chromosome 16 (position 29068843)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26944617
GRCz11 16 26818059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCGCACTTACTGGCAGGAGCTCCTGGATCTGAGCGTTCCTGGGGAG[C/T]AACCTGAGGTTGCGGAAGCTCTTGTGACTGCCTTTAAAAGGTTGGACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link