usp11

Ensembl ID:
ENSDARG00000076303
ZFIN ID:
ZDB-GENE-081104-421
Description:
Novel protein similar to vertebrate ubiquitin specific peptidase 11 (USP11) [Source:UniProtKB/TrEMBL
Human Orthologue:
USP11
Human Description:
ubiquitin specific peptidase 11 [Source:HGNC Symbol;Acc:12609]
Mouse Orthologue:
Usp11
Mouse Description:
ubiquitin specific peptidase 11 Gene [Source:MGI Symbol;Acc:MGI:2384312]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41123 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075624 Essential Splice Site 573 990 13 21
ENSDART00000131963   None 254 None 7
ENSDART00000142076 Essential Splice Site 587 598 13 14
Genomic Location (Zv9):
Chromosome 8 (position 9211329)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8627911
GRCz11 8 8666496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCACTGCACACCAGAACATCTCTACCAGCTCCTCCTGGAAAGACTGGC[G/A]TAAGTCTGACCATGAATACAGTAAATAGTGCATTGCCAGGGTCAGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link