
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001120780.1
- Ensembl ID:
- ENSDARG00000076302
- Description:
- deltex1 [Source:RefSeq peptide;Acc:NP_001120780]
- Human Orthologue:
- DTX4
- Human Description:
- deltex homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:29151]
- Mouse Orthologue:
- Dtx4
- Mouse Description:
- deltex 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2672905]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34029 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34029
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111636 | Essential Splice Site | 417 | 704 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 19780206)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 18313235 GRCz11 7 18565502 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTGTGAAGAACTTAAATGGATCCAGTCCTGTTCATCCCGCTCTGGCAG[G/T]TGAGAAACGATATGCAAATAGGGTATAAATAGTGGCTTTGATGATTAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: