zgc:174697

Ensembl ID:
ENSDARG00000076272
ZFIN ID:
ZDB-GENE-080213-11
Description:
Zgc:174697 protein [Source:UniProtKB/TrEMBL;Acc:A9JT89]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33486 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33487 Nonsense Mutation detected in F1 DNA During 2018
sa18617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111603 Essential Splice Site None 443 1 3
Genomic Location (Zv9):
Chromosome 4 (position 27729306)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28429583
GRCz11 4 28418871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGTGATTCAACCTATTTTACAGTCTATGGATTCAACTAGAGAAAGG[T/G]TTGTTTTAAAACTTTACACAGATATAAACCGACTGATTACAATTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111603 Nonsense 27 443 2 3
Genomic Location (Zv9):
Chromosome 4 (position 27730177)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28430454
GRCz11 4 28419742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGAAGATTGAAGAAACATTCACAGTCAAAGAGGAAGATCTGCAGGAA[C/T]AAACAGGTTGGTTTTCATTCTCAAAGACAAACTCAGTCATCTGATCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111603 Nonsense 143 443 3 3
Genomic Location (Zv9):
Chromosome 4 (position 27732878)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28433155
GRCz11 4 28422443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACTGGAGAGAGGCCSTACACATGCCAACAGTGTGGACAAAGCTTCTA[T/A]CATGCTGGAAACTTTGCAGTGCACAGGAGAATTCACACTGGAGAGAGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link