zgc:172131

Ensembl ID:
ENSDARG00000076269
ZFIN ID:
ZDB-GENE-080204-47
Description:
hypothetical protein LOC100002821 [Source:RefSeq peptide;Acc:NP_001103883]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14671 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109129 Nonsense 84 218 2 2
ENSDART00000129388 Nonsense 134 268 4 4
Genomic Location (Zv9):
Chromosome 10 (position 41993136)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40705845
GRCz11 10 40627031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTGACACCCCTGATTTCTTCGACGAAGACTTAAAAAACCAAACAGAA[C/T]AGATAAGAAAGTACAAAGAGCTCACTCAGCAARGACCTGATGTATATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link