
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-275j21.1
- Ensembl ID:
- ENSDARG00000076250
- ZFIN ID:
- ZDB-GENE-081105-157
- Description:
- Novel protein similar to H.sapiens RASEF, RAS and EF-hand domain containing (RASEF) [Source:UniProtK
- Human Orthologue:
- RASEF
- Human Description:
- RAS and EF-hand domain containing [Source:HGNC Symbol;Acc:26464]
- Mouse Orthologue:
- Rasef
- Mouse Description:
- RAS and EF hand domain containing Gene [Source:MGI Symbol;Acc:MGI:2448565]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21388 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21388
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108613 | Splice Site, Nonsense | 284 | 706 | 6 | 17 |
- Genomic Location (Zv9):
- Chromosome 8 (position 51850485)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 49600872 GRCz11 8 49589641 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGGACTCTCTGAAGAGTGATCTGACAGACCAGAGCATCAACTGTGAA[C/T]GGTACAGTGTGTGTGAGTGTGTCACTACGCGAGTCAACTTAGTTAATGAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: