wu:fb39e12

Ensembl ID:
ENSDARG00000076229
ZFIN ID:
ZDB-GENE-030131-681
Human Orthologue:
MKL1
Human Description:
megakaryoblastic leukemia (translocation) 1 [Source:HGNC Symbol;Acc:14334]
Mouse Orthologue:
Mkl1
Mouse Description:
MKL (megakaryoblastic leukemia)/myocardin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384495]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38884 Nonsense Mutation detected in F1 DNA During 2018
sa44757 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109874 Nonsense 260 1200 8 17
Genomic Location (Zv9):
Chromosome 12 (position 19805642)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18657803
GRCz11 12 18779677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTCTGGCTTTATTCAGTTCAAGTCCAGCACAGATCGGACCTATCAA[C/T]GATCAAAGAAACCCAAAGATAACAAGCCCAAAGTAAAGAAGCTGAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109874 Nonsense 312 1200 8 17
Genomic Location (Zv9):
Chromosome 12 (position 19805798)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18657959
GRCz11 12 18779833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTCGTACGCCAAAATCCTCCACCAGCAGCAGCTTTTCCTTCAGCTT[C/T]AGATCATCAACCAGCAGCAGCAGCACTACAACTACCACACCATCCTACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
  • Treatment response for severe sepsis : Beyond single-marker analyses: mining whole genome scans for insights into treatment responses in severe sepsis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link