zgc:174224

Ensembl ID:
ENSDARG00000076222
ZFIN ID:
ZDB-GENE-071004-118
Description:
Zgc:174224 protein [Source:UniProtKB/TrEMBL;Acc:A8E5B1]
Mouse Orthologue:
Gm9805
Mouse Description:
predicted gene 9805 Gene [Source:MGI Symbol;Acc:MGI:3642566]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43748 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106620 Essential Splice Site None 281 1 3
Genomic Location (Zv9):
Chromosome 22 (position 2108493)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2849583
GRCz11 22 2865849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTCAGCACTGACGCGTTCGTCCAGCGTCGAATCTTCAGAGCTAAGG[T/G]GAGTCGTTGACGCTTTTTCTCGTGTTTACACAACAATAAAACGCACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106620 Nonsense 153 281 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2112366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2853456
GRCz11 22 2869722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTACTCATGCTCTGACTGCGGAAAGAGATTTGCACATCAGTCGAATT[T/A]AAGTAAACACCAGAAGATCCACAGCGGTGTGAGAGAGCATGTGTGCTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link