zgc:198419

Ensembl ID:
ENSDARG00000076221
ZFIN ID:
ZDB-GENE-030131-7540
Description:
hypothetical protein LOC100006523 [Source:RefSeq peptide;Acc:NP_001107131]
Human Orthologue:
FTL
Human Description:
ferritin, light polypeptide [Source:HGNC Symbol;Acc:3999]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40092 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113789 Splice Site, Nonsense 85 175 3 4
Genomic Location (Zv9):
Chromosome 3 (position 32242934)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31974244
GRCz11 3 32105958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGTTTCTTGTGTAATGTGCTCACTGATCTTGTATTTGCTCTTCAG[A/T]AGCCTGATCGTGATGTTTGGGACAATGGACTGATTGCTATGCAGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link