wu:fj60a11

Ensembl ID:
ENSDARG00000076220
ZFIN ID:
ZDB-GENE-030131-8208
Human Orthologue:
SEZ6
Human Description:
seizure related 6 homolog (mouse) [Source:HGNC Symbol;Acc:15955]
Mouse Orthologue:
Sez6
Mouse Description:
seizure related gene 6 Gene [Source:MGI Symbol;Acc:MGI:104745]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110765 Nonsense 180 970 2 17
Genomic Location (Zv9):
Chromosome 10 (position 38211686)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36934701
GRCz11 10 36878459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCACAAACCCCACCGYTCCAACTAACACTCCCACAAGAACCAGTCAA[A/T]AGACAACTCTCACCACAATGACAAGGAAGGCCTTCAGCAAAGAAACTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link