vasn

Ensembl ID:
ENSDARG00000076215
ZFIN ID:
ZDB-GENE-050522-43
Description:
vasorin [Source:RefSeq peptide;Acc:NP_001018141]
Human Orthologue:
VASN
Human Description:
vasorin [Source:HGNC Symbol;Acc:18517]
Mouse Orthologue:
Vasn
Mouse Description:
vasorin Gene [Source:MGI Symbol;Acc:MGI:2177651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa55 Missense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa55
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113785 Missense 214 688 2 3
ENSDART00000124315 Missense 214 688 2 2
Genomic Location (Zv9):
Chromosome 22 (position 26392323)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25822408
GRCz11 22 25842305
KASP Assay ID:
554-0133.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAATAGCTGGATTGGGGCTGACCAGTTTGGATGAGGAGCTGTTAGGC[A/T]GCCTAGTAAATCTGCATGTTCTCGATGTTTCTCAGAACCAGCTTGTAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link