si:zfos-692b10.1

Ensembl ID:
ENSDARG00000076212
ZFIN ID:
ZDB-GENE-091113-27
Human Orthologue:
RPS6KC1
Human Description:
ribosomal protein S6 kinase, 52kDa, polypeptide 1 [Source:HGNC Symbol;Acc:10439]
Mouse Orthologue:
Rps6kc1
Mouse Description:
ribosomal protein S6 kinase polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2443419]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43370 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12395 Essential Splice Site Available for shipment Available now
sa43369 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Essential Splice Site 125 929 4 18
ENSDART00000146937   None 746 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3309288)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3252942
GRCz11 20 3270443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATATTCCTGCTTTATATGGCAGTTCATACATTCAAGATTTCTTTAAG[G/A]TATGTTTGTATTTATTTATTTATTTATTTATTTATTTATTCCAAGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Essential Splice Site 156 929 5 18
ENSDART00000146937   None 746 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3304889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3248543
GRCz11 20 3266044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTTTTCTGATTTTCTAGCTGAYAGYCTGTTAGACAGCAGTTCTGAAG[G/A]TARGTCTCTACACTATTTATTGCTCACAGGTTTATGTATTGCTCCCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Nonsense 581 929 13 18
ENSDART00000146937 Nonsense 402 746 6 10
Genomic Location (Zv9):
Chromosome 20 (position 3278011)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3231873
GRCz11 20 3249374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATAGAAATGATGCCTGTACGGCACTGTTACCTTCGGATGCTGATGTC[G/T]AGGTCTTAGAGGAGCCCCTGCAGAAGCCACAGGTTGTGTCAGATCTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link