
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
B0S4W0_DANRE
- Ensembl ID:
- ENSDARG00000076210
- Description:
- Novel protein similar to vertebrate zinc finger, FYVE domain containing 1 (ZFYVE1) [Source:UniProtKB
- Human Orthologue:
- ZFYVE1
- Human Description:
- zinc finger, FYVE domain containing 1 [Source:HGNC Symbol;Acc:13180]
- Mouse Orthologue:
- Zfyve1
- Mouse Description:
- zinc finger, FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3026685]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35822 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32020 | Essential Splice Site | Available for shipment | Available now |
sa28413 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa8402 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35822
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111385 | Nonsense | 242 | 654 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13809184)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14452527 GRCz11 15 14388484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTGGGCCAGAGCACAGACGCCTTCAGTTCGGTTCAGTATGTGGGCACA[C/T]AGACCATCACTCCCCCCACAGACTACTCACAGCTACAGCACACGGTCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32020
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111385 | Essential Splice Site | 385 | 654 | 6 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13786875)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14474836 GRCz11 15 14410793 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCCACAGACAACCCGTGGTTTGGTCTGGCCAAGTATGCGTGGTCTGGG[T/C]GAGTGAGATGCTGTATTCTGCTGTCTATGAAGCTGCTCCTCATACACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28413
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111385 | Essential Splice Site | 424 | 654 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13786681)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14475030 GRCz11 15 14410987 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCGGAGAGCAGTGTGGTGCGGCCAGAGGTCAAGCACGTCTGGCAGGGGG[T/C]GAGTGTTTCTGTTCATGTGTTCAGTCTGCTGATGCTCACAGTGGTTAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8402
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111385 | Nonsense | 459 | 654 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 13786510)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 14475201 GRCz11 15 14411158 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAATGAACTACATTATTCAGTCAGTGACAGAATACAGTTCAGGGCCGACC[A/T]AAGCTGTCGCYGCGTGGCTCACAGACCAGGTGGCTCCACCTTACTGGAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: