zgc:175202

Ensembl ID:
ENSDARG00000076189
ZFIN IDs:
ZDB-GENE-080303-31, ZDB-GENE-080303-31
Description:
Zgc:175202 protein [Source:UniProtKB/TrEMBL;Acc:B0JZN4]
Human Orthologues:
CCDC88A, CCDC88C
Human Descriptions:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
Mouse Orthologues:
Ccdc88a, Ccdc88c
Mouse Descriptions:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17648 Nonsense Available for shipment Available now
sa22541 Nonsense Available for shipment Available now
sa42447 Nonsense Mutation detected in F1 DNA During 2018
sa30679 Nonsense Mutation detected in F1 DNA During 2018
sa22542 Essential Splice Site Available for shipment Available now
sa45524 Nonsense Mutation detected in F1 DNA During 2018
sa2750 Nonsense Available for shipment Available now
sa30985 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103   None 983 3 30
ENSDART00000112470 Nonsense 78 1603 3 29
Genomic Location (Zv9):
Chromosome 14 (position 48639801)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46717460
GRCz11 14 45704752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKGTTGYTTGYTTGGGTTTTTTAWYCAGTGATCCCAATCCAAAGGTAGAA[C/T]AAATCTACCACAATGTGGGCGACGACAAGATTCGCAGAGTGCAGAACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103   None 983 7 30
ENSDART00000112470 Nonsense 211 1603 7 29
Genomic Location (Zv9):
Chromosome 14 (position 48654898)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46732557
GRCz11 14 45719849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACTGAACGGAGCCGAGCTGCAGATTCTTTTCTGCTCAATGGCCAAA[C/T]AGATCCAGAACCTGCTAGCCCAAAGAGACACACAGCTGGAGGTCAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103   None 983 12 30
ENSDART00000112470 Nonsense 408 1603 12 29
Genomic Location (Zv9):
Chromosome 14 (position 48663775)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46741434
GRCz11 14 45728726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTGACCAACTGTATGATTGTTTGTGTAGGAGCGGGATGTGGAGAGA[C/T]AGCGGGTGGACGAGCTGCTGGAGATGAACATGAGTCTGCAGGTGGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103   None 983 13 30
ENSDART00000112470 Nonsense 499 1603 13 29
Genomic Location (Zv9):
Chromosome 14 (position 48667241)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46744900
GRCz11 14 45732192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGAGAACGCCGAGCTGAGACGGCGACTGGAGCTCCTGCAGGCTGAA[C/T]AAGAGGTCAGCGGATGTTTGGCCAGATTTATCCTCAGGCTACCACCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103 Essential Splice Site None 983 13 30
ENSDART00000112470 Essential Splice Site 500 1603 13 29
Genomic Location (Zv9):
Chromosome 14 (position 48667247)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46744906
GRCz11 14 45732198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACGCCGAGCTGAGACGGCGACTGGAGCTCCTGCAGGCTGAACAAGAG[G/A]TCAGCGGATGTTTGGCCAGATTTATCCTCAGGCTACCACCTGGCTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103 Nonsense 711 983 25 30
ENSDART00000112470 Nonsense 1331 1603 24 29
Genomic Location (Zv9):
Chromosome 14 (position 48699030)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46776689
GRCz11 14 45763981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAAAAAATGTGACCGTAATTAATATCTTTATTATTTAGCTTCTCACG[C/T]AGCTGAAGGCAAACATGGAGGAGGAGAACCGACATCTAGTGGAGCAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103 Nonsense 908 983 28 30
ENSDART00000112470 Nonsense 1528 1603 27 29
Genomic Location (Zv9):
Chromosome 14 (position 48704138)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46781797
GRCz11 14 45769089
KASP Assay ID:
554-2868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCAAAGGCAGAGGAGRAGTTTCTCAGTCCTTCAGTCCAGGAGACCAG[C/T]GATCTCAGCCTCGCATCCGCCTGCGCTCCTCTCAGACAGGAGCCTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110103 Essential Splice Site 967 983 29 30
ENSDART00000112470 Essential Splice Site 1587 1603 28 29
Genomic Location (Zv9):
Chromosome 14 (position 48704933)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46782592
GRCz11 14 45769884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCACCTGCACATTCAGACGTCAGTCGTGTTTCATCTGGAACTGAAGG[T/C]CAGTCTGTGACATTGGTAGAACAAATCAAAACATGCACATTTCTGATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link