si:dkey-30j10.4

Ensembl ID:
ENSDARG00000076186
ZFIN ID:
ZDB-GENE-080327-11
Description:
cDNA, clone cssl:d0330 [Source:UniProtKB/TrEMBL;Acc:A8BB00]
Human Orthologues:
LRRC3, LRRC3B
Human Descriptions:
leucine rich repeat containing 3 [Source:HGNC Symbol;Acc:14965]
leucine rich repeat containing 3B [Source:HGNC Symbol;Acc:28105]
Mouse Orthologues:
Lrrc3, Lrrc3b
Mouse Descriptions:
leucine rich repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:2447899]
leucine rich repeat containing 3B Gene [Source:MGI Symbol;Acc:MGI:2384996]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15295 Nonsense Available for shipment Available now
sa26027 Nonsense Mutation detected in F1 DNA During 2018
sa6030 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113421 Nonsense 19 262 1 1
ENSDART00000147418 Nonsense 20 204 2 2
Genomic Location (Zv9):
Chromosome 3 (position 16393503)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16623722
GRCz11 3 16773522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATCCCATGGCCAGCTGCCTTTCTCTCACTCTCACCCTTTTTKTGTA[T/A]CAACTGGATGTGTGTGTGTCTKACTCCCACCACGAAGAATGCCCTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113421 Nonsense 186 262 1 1
ENSDART00000147418 Nonsense 187 204 2 2
Genomic Location (Zv9):
Chromosome 3 (position 16394003)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16624222
GRCz11 3 16774022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGTTATGTGCAATTCTTCTGAACCCCAAGAGCTGGGGGCTCAGGGTT[T/A]GCCCTTCATCCTGGTGGCGACTGATTTGGATTTTTGTGCAACCATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113421 Nonsense 195 262 1 1
ENSDART00000147418 Nonsense 196 204 2 2
Genomic Location (Zv9):
Chromosome 3 (position 16394030)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16624249
GRCz11 3 16774049
KASP Assay ID:
554-3654.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGAGCTGGGGGCTCAGGGTTTGCCCTTCATCCTGGTGGCGACTGATT[T/A]GGATTTTTGYGCARCCATCAGGAGGACTACTGACGTGGCGATGCTGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link