
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-215c3.2
- Ensembl ID:
- ENSDARG00000076171
- ZFIN ID:
- ZDB-GENE-090312-211
- Description:
- Novel protein similar to H.sapiens ZNF827, zinc finger protein 827 (ZNF827) [Source:UniProtKB/TrEMBL
- Human Orthologue:
- ZNF827
- Human Description:
- zinc finger protein 827 [Source:HGNC Symbol;Acc:27193]
- Mouse Orthologue:
- Zfp827
- Mouse Description:
- zinc finger protein 827 Gene [Source:MGI Symbol;Acc:MGI:2444807]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18170 | Nonsense | Available for shipment | Available now |
sa19530 | Nonsense | Available for shipment | Available now |
sa4854 | Nonsense | F2 line generated | During 2018 |
sa9707 | Nonsense | Available for shipment | Available now |
sa12453 | Essential Splice Site | Available for shipment | Available now |
sa14020 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18170
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Nonsense | 267 | 1150 | 2 | 14 |
ENSDART00000139883 | None | 138 | None | 2 | |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35826973)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35386831 GRCz11 1 36118858 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCCGCCAACGCCGTGCTCCAAGACAAGAACGCGGTGGCCTCCTCCACCT[C/A]GGCATCTTCATCCTCCTCGTCCTCCTCCTCATCCTCTTCAGTCACCTCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19530
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Nonsense | 703 | 1150 | 5 | 14 |
ENSDART00000139883 | None | 138 | None | 2 | |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35786565)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35346423 GRCz11 1 36078450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCAAGAGAGGAGGGGAGCCCGATGTTGGGCAAGAGCAGCCTTCTCAGC[C/T]AGGACATCAACGTCAAAGTGGCCTCTGAATTGCTTATGAAGCTCTCAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4854
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Nonsense | 773 | 1150 | 6 | 14 |
ENSDART00000139883 | None | 138 | None | 2 | |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35765317)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35325175 GRCz11 1 36057202 - KASP Assay ID:
- 554-3542.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAGGACCATGTGAAAAGAAGGAACCAATGGTCAACCTCCMAGATCATT[T/A]GCCCCGCCCCCAGAATGACCTCTTCTCGCAGGACATATCGGTCAAAATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9707
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Nonsense | 908 | 1150 | 10 | 14 |
ENSDART00000139883 | Nonsense | 37 | 138 | 2 | 2 |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35745049)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35304907 GRCz11 1 36036934 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTTTGTCTCTACAGAAGAGAGGAAATACAAGTGTCATTTGTGTCCATA[T/A]GCAGCTAAGTGCCGAGCMAACCTCAACCAGCACCTCACCATCCACTCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12453
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Essential Splice Site | 1076 | 1150 | 11 | 14 |
ENSDART00000139883 | None | 138 | None | 2 | |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35740349)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35300207 GRCz11 1 36032234 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAAGCCAATCAAGCTTAGGCCCAGGAGCAGAGGAAAAAGCAGAGAAAGG[T/C]GAGACTTTTAGCAGATACACCTAGCGCATTTTATCCCTGATTAAGAGTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14020
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000037516 | Nonsense | 1092 | 1150 | 12 | 14 |
ENSDART00000139883 | None | 138 | None | 2 | |
ENSDART00000141562 | None | 196 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 35737849)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 35297707 GRCz11 1 36029734 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCTTTGAATGCGTCTTCTGCAACTTTGTGTGTAAAACCCGACCCATGTA[C/A]GAGCGGCACCTAMAGATCCACCTGATCAYGYGCATGTTTGAGTGTGACGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Dental caries: GWAS of dental caries patterns in the permanent dentition. (View Study)
- Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)
- Liver enzyme levels (gamma-glutamyl transferase): Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma. (View Study)
- Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: