zgc:136471

Ensembl ID:
ENSDARG00000076169
ZFIN ID:
ZDB-GENE-060512-59
Description:
DNA polymerase delta subunit 3 [Source:RefSeq peptide;Acc:NP_001036234]
Human Orthologue:
POLD3
Human Description:
polymerase (DNA-directed), delta 3, accessory subunit [Source:HGNC Symbol;Acc:20932]
Mouse Orthologue:
Pold3
Mouse Description:
polymerase (DNA-directed), delta 3, accessory subunit Gene [Source:MGI Symbol;Acc:MGI:1915217]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43633 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37291 Nonsense Mutation detected in F1 DNA During 2018
sa12114 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101700 Essential Splice Site 38 457 2 12
Genomic Location (Zv9):
Chromosome 21 (position 20696094)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21707587
GRCz11 21 21744223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATGGCTCAGTTTAACCCTTGGAGTCCATGTGAACACAGCAAAACAG[T/A]AAGTCAAGTCCCTTTATGCCTCTCAATGTATTCAGTTATTTGTCACTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101700 Nonsense 60 457 3 12
Genomic Location (Zv9):
Chromosome 21 (position 20696252)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21707745
GRCz11 21 21744381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGCAAAAACGTAATGAAAGTTCAGGGACAGCTCTTCATGCTACTTA[T/A]CTTGTATCCGGCAAGTGTGTTGAGAATGGGACTCCGGTAAGAACTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101700 Essential Splice Site 390 457 12 12
Genomic Location (Zv9):
Chromosome 21 (position 20706256)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21717749
GRCz11 21 21754385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTGACAATGTCTCTGTGACATTAAATAACCTGTTTCTRTTTTTCTA[G/T]TAACTGAGAAAGGTTATGTGAGCGAGTCTTACTCTGAGAGTGAAGARGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link