si:dkey-241o6.2

Ensembl ID:
ENSDARG00000076153
ZFIN ID:
ZDB-GENE-090313-268
Human Orthologues:
LCA5, LCA5L
Human Descriptions:
Leber congenital amaurosis 5 [Source:HGNC Symbol;Acc:31923]
Leber congenital amaurosis 5-like [Source:HGNC Symbol;Acc:1255]
Mouse Orthologues:
Lca5, Lca5l
Mouse Descriptions:
Leber congenital amaurosis 5 (human) Gene [Source:MGI Symbol;Acc:MGI:1923032]
Leber congenital amaurosis 5-like Gene [Source:MGI Symbol;Acc:MGI:3041157]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9927 Essential Splice Site Available for shipment Available now
sa37755 Nonsense Mutation detected in F1 DNA During 2018
sa11604 Nonsense Available for shipment Available now
sa1415 Missense, Nonsense Available for shipment Available now
sa10874 Missense, Nonsense Available for shipment Available now
sa6746 Nonsense Mutation detected in F1 DNA During 2018
sa37754 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Essential Splice Site 294 753 2 7
ENSDART00000132736 Essential Splice Site 294 460 3 8
Genomic Location (Zv9):
Chromosome 23 (position 31629409)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31464299
GRCz11 23 31390830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAATTGGCACTCAAAGCAGATTGCAAGATAGTGAACACAGAGTGAAGG[T/C]AAAAACATTTAAAAAACTAACTAACTAAGTATAGCAATGTCTTGCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 385 753 5 7
ENSDART00000132736 Nonsense 385 460 6 8
Genomic Location (Zv9):
Chromosome 23 (position 31626532)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31461422
GRCz11 23 31387953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTGTGTTAAAGGCTTTAATATAACCAGCACTAAAGCAGTACAGACA[G/T]AGGACAGAACATCCTCATTGGATTTCCCATCGCCACCTCCAGCTCTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 391 753 5 7
ENSDART00000132736 Nonsense 391 460 6 8
Genomic Location (Zv9):
Chromosome 23 (position 31626513)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31461403
GRCz11 23 31387934
KASP Assay ID:
2261-7993.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATAACCAGCACTAAAGCAGTACAGACAGAGGACAGAACATCCTCAT[T/A]GGATTTCCCATCGCCACCTCCAGCTCTTACCAATAATCTTCCACCTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Missense 420 753 6 7
ENSDART00000132736 Nonsense 420 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623265)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31458155
GRCz11 23 31384686
KASP Assay ID:
554-1336.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTGTCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCA[A/T]AGCAGAGAGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 423 753 6 7
ENSDART00000132736 Missense 422 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623258)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31458148
GRCz11 23 31384679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCAWAGCAGA[G/T]AGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTTTTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 493 753 6 7
ENSDART00000132736   None 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623048)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31457938
GRCz11 23 31384469
KASP Assay ID:
554-4700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACTAGATCAAGATCTCAGCTCAAATGAGAAGAACTTTAAAGGAAAC[A/T]GAGGTAGGAATGTAGAAGCCACCATAATTCACTGATAATACAGCTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 516 753 7 7
ENSDART00000132736   None 460 8 8
Genomic Location (Zv9):
Chromosome 23 (position 31620009)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31454899
GRCz11 23 31381430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGACAGGAGGATTGGCATGTCTGTGTCTCAAAAGGAAGAAGAGATC[C/T]AAAAGCAGCGTGAACTGGAAGAGGAGCAACAAAAAGTGAGAAATCGGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link