
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:172075
- Ensembl ID:
- ENSDARG00000076146
- ZFIN ID:
- ZDB-GENE-080215-3
- Description:
- hypothetical protein LOC555875 [Source:RefSeq peptide;Acc:NP_001107880]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15056 | Nonsense | Available for shipment | Available now |
sa26866 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18860 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9361 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15056
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064274 | Nonsense | 21 | 543 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 2861961)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 2438018 GRCz11 7 2246080 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAAATGTTTTCTTACATCTGTGTATTACAGAAGGCCAAATCCTCCACCA[C/T]GAAGACCAAAACTGATTCATCGAGGTCCTCCAGCAAGATACCTTCTGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26866
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064274 | Nonsense | 284 | 543 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 2862750)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 2438807 GRCz11 7 2246869 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTATGGATGGCATGAAAGAGTTCTTTCAATCTCTGACTGCAAGGAAC[A/T]GAAGAAGTTTAGAGTTGACTTCAGATGTCCTGATTGAGCGCATTCAGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18860
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064274 | Nonsense | 423 | 543 | 2 | 2 |
ENSDART00000064274 | Nonsense | 423 | 543 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 2863169)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 2439226 GRCz11 7 2247288 - KASP Assay ID:
- 2259-8354.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTAAACACGTCAAAGAGAACAAGAAATATGTAATCAGCACTTCAAGCTA[C/A]ATGATGGAATTTGACTACGTAAAAAAGGAATGTGAAAAAGTTCAAAAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064274 | Nonsense | 423 | 543 | 2 | 2 |
ENSDART00000064274 | Nonsense | 423 | 543 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 2863169)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 2439226 GRCz11 7 2247288 - KASP Assay ID:
- 2259-8354.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTAAACACGTCAAAGAGAACAAGAAATAYGTAATCAGCACTTCAAGCTA[C/A]ATGATGGAATTTGACTACGTAAAAAAGGAATGTGAAAAAGTTCAAAAACW
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: