zgc:172075

Ensembl ID:
ENSDARG00000076146
ZFIN ID:
ZDB-GENE-080215-3
Description:
hypothetical protein LOC555875 [Source:RefSeq peptide;Acc:NP_001107880]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15056 Nonsense Available for shipment Available now
sa26866 Nonsense Mutation detected in F1 DNA During 2018
sa18860 Nonsense Mutation detected in F1 DNA During 2018
sa9361 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064274 Nonsense 21 543 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2861961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2438018
GRCz11 7 2246080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATGTTTTCTTACATCTGTGTATTACAGAAGGCCAAATCCTCCACCA[C/T]GAAGACCAAAACTGATTCATCGAGGTCCTCCAGCAAGATACCTTCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064274 Nonsense 284 543 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2862750)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2438807
GRCz11 7 2246869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTATGGATGGCATGAAAGAGTTCTTTCAATCTCTGACTGCAAGGAAC[A/T]GAAGAAGTTTAGAGTTGACTTCAGATGTCCTGATTGAGCGCATTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064274 Nonsense 423 543 2 2
ENSDART00000064274 Nonsense 423 543 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2863169)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2439226
GRCz11 7 2247288
KASP Assay ID:
2259-8354.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAAACACGTCAAAGAGAACAAGAAATATGTAATCAGCACTTCAAGCTA[C/A]ATGATGGAATTTGACTACGTAAAAAAGGAATGTGAAAAAGTTCAAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064274 Nonsense 423 543 2 2
ENSDART00000064274 Nonsense 423 543 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2863169)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2439226
GRCz11 7 2247288
KASP Assay ID:
2259-8354.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAAACACGTCAAAGAGAACAAGAAATAYGTAATCAGCACTTCAAGCTA[C/A]ATGATGGAATTTGACTACGTAAAAAAGGAATGTGAAAAAGTTCAAAAACW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link