CLCF1

Ensembl ID:
ENSDARG00000076140
Description:
cardiotrophin-like cytokine factor 1 [Source:HGNC Symbol;Acc:17412]
Human Orthologue:
CLCF1
Human Description:
cardiotrophin-like cytokine factor 1 [Source:HGNC Symbol;Acc:17412]
Mouse Orthologues:
Clcf1, Ctf2
Mouse Descriptions:
cardiotrophin 2 Gene [Source:MGI Symbol;Acc:MGI:2684607]
cardiotrophin-like cytokine factor 1 Gene [Source:MGI Symbol;Acc:MGI:1930088]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45514 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109896 Essential Splice Site 146 176 2 4
Genomic Location (Zv9):
Chromosome 14 (position 23038331)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21737889
GRCz11 14 22035134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACCCCTGCTCAAGGATATGCCCCAGCCATGTCATCACAGTTTCAGGG[T/C]GTGAGCGAGAACAGCCCCGCCCCTCTACGGAGTTACGTGCCTCGAAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link