zgc:162972

Ensembl ID:
ENSDARG00000076134
ZFIN ID:
ZDB-GENE-070424-49
Description:
Zgc:162972 protein [Source:UniProtKB/TrEMBL;Acc:A3KP62]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43213 Nonsense Mutation detected in F1 DNA During 2018
sa18569 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113979 Nonsense 156 459 2 3
ENSDART00000143117 Nonsense 156 459 2 2
Genomic Location (Zv9):
Chromosome 19 (position 7522861)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6981400
GRCz11 19 6900325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAAACCTTACACATGTCAAAATTGTGGGAAGAGTTTCAGAGAGAAA[C/T]AAATCCTCGACACGCACTTGACGATTCACACTGGAGAAAAGCCTTACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113979 Nonsense 212 459 2 3
ENSDART00000143117 Nonsense 212 459 2 2
Genomic Location (Zv9):
Chromosome 19 (position 7523029)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6981568
GRCz11 19 6900493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAAACCTTACAYRTGCCAAGAGTGTGGAAAGAGTTTTGCAATAAAA[C/T]AAAACCTAGAAAGGCACATGAGAATTCACACTGGAGAAAAGCCTTACTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link